Browse wiki

Jump to: navigation, search
Sequence 1227(M VCAM-1)
Application Gene expression +
Chemistry DNA +
Description Vascular cell adhesion molecule 1 Ensembl: ENSMUSG00000027962 UniGene: Mm.76649 EntrezGene: 22329 Ensembl Chr3: 115812940 - 115832606 Strand: -1 GO terms: 0005021 0005515 0005524 0005615 0006468 0007155 0016020 0016021 0016337 0048503
Design Primer set +
Name M VCAM-1  +
Sequence Forward PCR primer (22b) CTAATTCATGGTAGAATGGCTA / Reverse PCR primer (22b) TGAAGTCGCATTTAAATCAGGT
Target Vcam1 ( Mus musculus ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:21  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders