Browse wiki
| Sequence 1229(M VEGF) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Vascular endothelial growth factor A Ense … Vascular endothelial growth factor A Ensembl: ENSMUSG00000023951 UniGene: Mm.282184 EntrezGene: 22339 Ensembl Chr17: 46153942 - 46168699 Strand: -1 GO terms: 0000074 0001541 0001569 0001666 0001938 0001974 0002053 0005604 0005615 0005737 0006916 0007275 0007399 0007498 0008083 0008201 0008283 0009967 0016020 0016477 0030324 0030855 004208867 0016020 0016477 0030324 0030855 0042088 |
| Design | Primer set + |
| Name | M VEGF + |
| Sequence | Forward PCR primer (21b) CATCTTCAAGCCGTCCTGTGT / Reverse PCR primer (21b) CTCCAGGGCTTCATCGTTACA |
| Target | Vegfa ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:08 + |
| hide properties that link here |
| No properties link to this page. |
