Browse wiki
| Sequence 1249(XIAP) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | X-linked inhibitor of apoptosis protein E … X-linked inhibitor of apoptosis protein Ensembl: ENSG00000101966 UniGene: Hs.356076 , Hs.560150 , Hs.598042 , Hs.626277 EntrezGene: 331 Ensembl ChrX: 122821729 - 122875503 Strand: 1 GO terms: 0004869 0005515 0005622 0005737 0005829 0006915 0006916 0008270 0043027 0043154 004687215 0006916 0008270 0043027 0043154 0046872 |
| Design | SiRNA + |
| Name | XIAP + |
| Sequence | siRNA sense (21b) GTGGTAGTCCTGTTTCAGCTT / siRNA antisense (21b) GCTGAAACAGGACTACCACTT |
| Target | XIAP ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:15 + |
| hide properties that link here |
| No properties link to this page. |
