Browse wiki
| Sequence 1250(XLOC 000170 , XLOC000170) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | XLOC_000170 , XLOC000170 + |
| Sequence | Forward PCR primer (21b) AACGCAATCGAGGATAAACTG / Reverse PCR primer (19b) CATTTGCTGCTGGACCTTC |
| Target | XLOC 000170 ( Nicotiana benthamiana ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
| hide properties that link here |
| No properties link to this page. |
