Browse wiki
| Sequence 1259(XLOC 008050 , XLOC008050) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | XLOC_008050 , XLOC008050 + |
| Sequence | Forward PCR primer (20b) TCAATTGAACCACGTGCACC / Reverse PCR primer (21b) ATTGCTCTTCGCTCCTTGACA |
| Target | XLOC 008050 ( Nicotiana benthamiana ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
| hide properties that link here |
| No properties link to this page. |
