Browse wiki
| Sequence 1276(XRN1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | 5'-3' exoribonuclease 1 Ensembl: ENSG00000114127 UniGene: Hs.435103 EntrezGene: 54464 Ensembl Chr3: 143508139 - 143649543 Strand: -1 GO terms: 0003676 0003677 0003723 0003725 0004527 0005622 0005737 0007049 0016787 0045786 |
| Design | SiRNA + |
| Name | XRN1 + |
| Sequence | siRNA sense (21b) GGTGTTGTTTCGCATTATTTT / siRNA antisense (21b) AATAATGCGAAACAACACCTT |
| Target | XRN1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:12 + |
| hide properties that link here |
| No properties link to this page. |
