Browse wiki
| Sequence 1279(hYAP) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Yes-associated protein 1, 65kDa Ensembl: ENSG00000118181 |
| Design | SiRNA + |
| Name | hYAP + |
| Sequence | siRNA sense (21b) GACATCTTCTGGTCAGAGATT / siRNA antisense (21b) TCTCTGACCAGAAGATGTCTT |
| Target | YAP1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
| hide properties that link here |
| No properties link to this page. |
