Browse wiki
| Sequence 1280(siYWHAZ.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Tyrosine 3-monooxygenase/tryptophan 5-mono … Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide Ensembl: ENSG00000119950 UniGene: Hs.492407 EntrezGene: 7534 Ensembl Chr10: 111957353 - 112037113 Strand: 1 GO terms: 0003677 0003714 0005634 0005737 0006355 0008285 0030528 0042994 004544937 0006355 0008285 0030528 0042994 0045449 |
| Design | SiRNA + |
| Name | siYWHAZ.2 + |
| Sequence | siRNA sense (21b) GGTTTATGTTACTTCTATTTT / siRNA antisense (21b) AATAGAAGTAACATAAACCTG |
| Target | YWHAZ (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
| hide properties that link here |
| No properties link to this page. |
