Browse wiki
Sequence 1283(EWS/FLI-1 3 , EWS/FLI13) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Zinc finger protein 36, C3H type-like 1 E … Zinc finger protein 36, C3H type-like 1 Ensembl: ENSG00000185650 UniGene: Hs.85155 EntrezGene: 677 Ensembl Chr14: 68325077 - 68331206 Strand: -1 GO terms: 0000288 0001570 0003676 0003700 0003729 0005515 0005634 0005737 0005829 0006402 0006417 0008270 0043488 004687229 0006402 0006417 0008270 0043488 0046872 |
Design | SiRNA + |
Name | EWS/FLI-1_3 , EWS/FLI13 + |
Sequence | siRNA sense (21b) GAATACAGAGCAACGGCCCTT / siRNA antisense (21b) GGGCCGTTGCTCTGTATTCTT |
Target | ZFP36L1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:29 + |
hide properties that link here |
No properties link to this page. |