Browse wiki
| Sequence 156 (siAKT3.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | V-akt murine thymoma viral oncogene homolo … V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) Ensembl: ENSG00000117020 UniGene: Hs.498292 EntrezGene: 10000 Ensembl Chr1: 241718158 - 242080053 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0005515 0005524 0005737 0006468 0007165 0016020 001674024 0005737 0006468 0007165 0016020 0016740 |
| Design | SiRNA + |
| Name | siAKT3.2 + |
| Sequence | siRNA sense (21b) GCAGCTCCAACTTATATAATT / siRNA antisense (21b) TTATATAAGTTGGAGCTGCGT |
| Target | AKT3 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:29 + |
| hide properties that link here |
| No properties link to this page. |
