Browse wiki
Sequence 169 (SP-1271 , SP1271) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Alkaline phosphatase, placental ( Regan isozyme ) Ensembl: ENSG00000163283 UniGene: Hs.284255 EntrezGene: 250 Ensembl Chr2: 232951592 - 232955841 Strand: 1 GO terms: 0000287 0004035 0008152 0008270 0009986 0016020 0016021 0016787 0048503 |
Design | SiRNA + |
Name | SP-1271 , SP1271 + |
Sequence | siRNA sense (21b) CGGATGTTACCGAGAGCGATT / siRNA antisense (21b) TCGCTCTCGGTAACATCCGTT |
Target | ALPP ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:22 + |
hide properties that link here |
No properties link to this page. |