Browse wiki
| Sequence 189 (APH-1 , APH1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Anterior pharynx defective 1 homolog A ( C … Anterior pharynx defective 1 homolog A ( C. elegans ) Ensembl: ENSG00000117362 UniGene: Hs.108408 EntrezGene: 51107 Ensembl Chr1: 148502512 - 148508156 Strand: -1 GO terms: 0005515 0005783 0005794 0005887 0006509 0007220 0016020 0016021 0016485 0031293 0042987 004308520 0016021 0016485 0031293 0042987 0043085 |
| Design | SiRNA + |
| Name | APH-1 , APH1 + |
| Sequence | siRNA sense (21b) GAAGGCAGATGAGGGGTTATT / siRNA antisense (21b) TAACCCCTCATCTGCCTTCTT |
| Target | APH1A ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:33 + |
| hide properties that link here |
| No properties link to this page. |
