Browse wiki
| Sequence 197 (siARHGEF12.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Rho guanine nucleotide exchange factor (GEF) 12 Ensembl: ENSG00000196914 UniGene: Hs.24598 EntrezGene: 23365 Ensembl Chr11: 119713156 - 119865855 Strand: 1 GO terms: 0005085 0005089 0005096 0005515 0005622 0005737 0007242 0016020 0035023 |
| Design | SiRNA + |
| Name | siARHGEF12.1 + |
| Sequence | siRNA sense (21b) CGTTTAGCCCTGTCATTAATT / siRNA antisense (21b) TTAATGACAGGGCTAAACGTG |
| Target | ARHGEF12 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:18:15 + |
| hide properties that link here |
| No properties link to this page. |
