Browse wiki
| Sequence 200 (arrestin-1 , arrestin1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Arrestin, beta 1 Ensembl: ENSG00000137486 UniGene: Hs.503284 EntrezGene: 408 Ensembl Chr11: 74654130 - 74740525 Strand: -1 GO terms: 0004857 0005515 0005624 0005625 0005737 0005834 0005886 0007165 0007600 0050896 |
| Design | SiRNA + |
| Name | arrestin-1 , arrestin1 + |
| Sequence | siRNA sense (21b) AGCCTTCTGCGCGGAGAATTT / siRNA antisense (21b) ATTCTCCGCGCAGAAGGCTTT |
| Target | ARRB1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:21 + |
| hide properties that link here |
| No properties link to this page. |
