Browse wiki
| Sequence 271 (siBAG3.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | BCL2-associated athanogene 3 Ensembl: ENSG00000106588 UniGene: Hs.702046 EntrezGene: 9531 Ensembl Chr7: 42922989 - 42938330 Strand: -1 GO terms: 0004175 0004298 0005515 0005634 0005737 0005829 0005839 0006511 |
| Design | SiRNA + |
| Name | siBAG3.2 + |
| Sequence | siRNA sense (21b) CGATGTGTGCTTTAGGGAATT / siRNA antisense (21b) TTCCCTAAAGCACACATCGGT |
| Target | BAG3 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
| hide properties that link here |
| No properties link to this page. |
