Browse wiki
| Sequence 277 (BARX2si3) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | BARX homeobox 2 Ensembl: ENSG00000043039 UniGene: Hs.591944 EntrezGene: 8538 Ensembl Chr11: 128751045 - 128827014 Strand: 1 GO terms: 0000122 0003682 0003700 0003702 0005515 0005634 0005667 0006355 0006366 0030154 0042637 0043565 0045445 |
| Design | ShRNA + |
| Name | BARX2si3 + |
| Sequence | (64b) GATCCCAAGGAGACCTGCGATTACTTTTCAAGAGAAAGTAATCGCAGGTCTCCTTGTTTTTAAC / |
| Target | BARX2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:29 + |
| hide properties that link here |
| No properties link to this page. |
