Browse wiki
| Sequence 280 (mBcl-x , mBclx) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | B-cell leukemia/lymphoma 2 Ensembl: ENSM … B-cell leukemia/lymphoma 2 Ensembl: ENSMUSG00000057329 UniGene: Mm.257460 EntrezGene: 12043 Ensembl Chr1: 108434755 - 108610851 Strand: -1 GO terms: 0000074 0001666 0001836 0002020 0005515 0005634 0005737 0005739 0005741 0005783 0005829 0006916 0007584 0008284 0009408 0009636 0010035 0010039 0016020 0016021 0031000 0031069 003196539 0016020 0016021 0031000 0031069 0031965 |
| Design | SiRNA + |
| Name | mBcl-x , mBclx + |
| Sequence | siRNA sense (21b) GGATACAGCTGGAGTCAGTTT / siRNA antisense (21b) ACTGACTCCAGCTGTATCCTT |
| Target | Bcl2 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:31 + |
| hide properties that link here |
| No properties link to this page. |
