Browse wiki
| Sequence 285 (Bcl-2 , Bcl2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | B-cell CLL/lymphoma 2 Ensembl: ENSG000001 … B-cell CLL/lymphoma 2 Ensembl: ENSG00000171791 UniGene: Hs.150749 EntrezGene: 596 Ensembl Chr18: 58941559 - 59138341 Strand: -1 GO terms: 0000074 0001666 0001836 0002020 0005515 0005634 0005737 0005739 0005741 0005783 0005829 0006916 0006959 0007565 0007584 0008284 0009314 0009408 0009636 0010035 0010039 0016020 001602108 0009636 0010035 0010039 0016020 0016021 |
| Design | ShRNA + |
| Name | Bcl-2 , Bcl2 + |
| Sequence | (49b) GTGATGAAGTACATCCATTTTCAAGAGAAATGGATGTACTTCATCACTT |
| Target | BCL2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:29 + |
| hide properties that link here |
| No properties link to this page. |
