Browse wiki
| Sequence 30 (HPRT1) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | ATP-binding cassette, sub-family A ( ABC1 ), member 1 Ensembl: ENSG00000129673 UniGene: Hs.429294 EntrezGene: 19 Ensembl Chr17: 71961028 - 71977793 Strand: 1 GO terms: 0004059 0007623 0008080 0008152 0008415 0016740 |
| Design | Primer set + |
| Name | HPRT1 + |
| Sequence | Forward PCR primer (21b) TGACACTGGCAAAACAATGCA / Reverse PCR primer (21b) GGTCCTTTTCACCAGCAAGCT |
| Target | ABCA1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
| hide properties that link here |
| No properties link to this page. |
