Browse wiki
| Sequence 302 (bestrophin) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Bestrophin 1 Ensembl: ENSG00000167995 UniGene: Hs.705554 EntrezGene: 7439 |
| Design | SiRNA + |
| Name | bestrophin + |
| Sequence | siRNA sense (21b) CACAAGCAGTTGGAGAAACTT / siRNA antisense (21b) GTTTCTCCAACTGCTTGTGTT |
| Target | BEST1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:26 + |
| hide properties that link here |
| No properties link to this page. |
