Browse wiki

Jump to: navigation, search
Sequence 310 (sh mWASP)
Application Gene silencing +
Chemistry RNA +
Description BUB1 budding uninhibited by benzimidazolesBUB1 budding uninhibited by benzimidazoles 1 homolog ( yeast ) Ensembl: ENSG00000169679 UniGene: Hs.469649 EntrezGene: 699 Ensembl Chr2: 111111883 - 111152135 Strand: -1 GO terms: 0000166 0000776 0004672 0004674 0005524 0005634 0005816 0006468 0007049 0007067 0007094 0008283 0016740 005130149 0007067 0007094 0008283 0016740 0051301
Design ShRNA +
Name sh_mWASP  +
Sequence (70b) AGATCTCCGACGAGATGCTCCAAATGGTTCAAGAGACCATTTGGAGCATCTCGTCTTTTTGGAAAAGCTT
Target BUB1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:42  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders