Browse wiki
Sequence 316 (Cand1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Cullin-associated and neddylation-dissociated 1 Ensembl: ENSG00000111530 UniGene: Hs.546407 EntrezGene: 55832 Ensembl Chr12: 65949426 - 65994658 Strand: 1 GO terms: 0000151 0005515 0005634 0006350 0006355 0016563 0016567 0030154 0043086 0045899 |
Design | SiRNA + |
Name | Cand1 + |
Sequence | siRNA sense (21b) TGATTTGATGACGGAACTGTT / siRNA antisense (21b) CAGTTCCGTCATCAAATCATT |
Target | CAND1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:33 + |
hide properties that link here |
No properties link to this page. |