Browse wiki
| Sequence 320 (CAV1-1 , CAV11) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Caveolin 1, caveolae protein, 22kDa Ensem … Caveolin 1, caveolae protein, 22kDa Ensembl: ENSG00000131100 UniGene: Hs.74034 EntrezGene: 857 Ensembl Chr22: 16454902 - 16491588 Strand: -1 GO terms: 0005515 0005737 0005739 0005886 0006811 0008553 0015986 0015991 0015992 0016469 0016787 0046872 0046933 004696192 0016469 0016787 0046872 0046933 0046961 |
| Design | SiRNA + |
| Name | CAV1-1 , CAV11 + |
| Sequence | siRNA sense (21b) CCTGATTGAGATTCAGTGCTT / siRNA antisense (21b) GCACTGAATCTCAATCAGGTT |
| Target | CAV1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:29 + |
| hide properties that link here |
| No properties link to this page. |
