Browse wiki
| Sequence 334 (CCR7) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Chemokine ( C-C motif ) receptor 7 Ensemb … Chemokine ( C-C motif ) receptor 7 Ensembl: ENSG00000126353 UniGene: Hs.370036 EntrezGene: 1236 Ensembl Chr17: 35963550 - 35975250 Strand: -1 GO terms: 0001584 0004872 0004918 0004945 0004947 0004983 0005886 0005887 0006935 0006954 0007165 0007186 0007204 0016021 0016493 0016494 004502886 0007204 0016021 0016493 0016494 0045028 |
| Design | SiRNA + |
| Name | CCR7 + |
| Sequence | siRNA sense (21b) GAGGCTCAAGACCATGACCTT / siRNA antisense (21b) GGTCATGGTCTTGAGCCTCTT |
| Target | CCR7 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:12 + |
| hide properties that link here |
| No properties link to this page. |
