Browse wiki
Sequence 335 (CCRi-436 , CCRi436) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Chemokine ( C-C motif ) receptor 9 Ensemb … Chemokine ( C-C motif ) receptor 9 Ensembl: ENSG00000173585 UniGene: Hs.225946 EntrezGene: 10803 Ensembl Chr3: 45903023 - 45919671 Strand: 1 GO terms: 0001584 0004872 0004918 0004942 0004945 0004947 0005515 0005886 0005887 0006935 0006955 0006968 0007165 0007186 0007204 0016021 0016493 001649465 0007186 0007204 0016021 0016493 0016494 |
Design | SiRNA + |
Name | CCRi-436 , CCRi436 + |
Sequence | siRNA sense (21b) GGTGGTCAACAGCATGTACTT / siRNA antisense (21b) GTTCATGCTGTTGACCACCTT |
Target | CCR9 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:30 + |
hide properties that link here |
No properties link to this page. |