Browse wiki
| Sequence 343 (CD74) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | CD74 molecule, major histocompatibility co … CD74 molecule, major histocompatibility complex, class II invariant chain Ensembl: ENSG00000019582 UniGene: Hs.436568 EntrezGene: 972 Ensembl Chr5: 149761426 - 149772685 Strand: -1 GO terms: 0000187 0001516 0005622 0006457 0006461 0006886 0006955 0007165 0008283 0016020 0016021 0016064 0019882 0019883 0019955 0042289 0042802 0043030 0043066 004505855 0042289 0042802 0043030 0043066 0045058 |
| Design | SiRNA + |
| Name | CD74 + |
| Sequence | siRNA sense (21b) ACTGACAGTCACCTCCCAGTT / siRNA antisense (21b) CTGGGAGGTGACTGTCAGTTT |
| Target | CD74 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:14 + |
| hide properties that link here |
| No properties link to this page. |
