Browse wiki
| Sequence 344 (siKAI1.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | CD82 molecule Ensembl: ENSG00000085117 UniGene: Hs.527778 EntrezGene: 3732 Ensembl Chr11: 44543717 - 44597889 Strand: 1 GO terms: 0005515 0005886 0005887 0016020 0016021 |
| Design | SiRNA + |
| Name | siKAI1.1 + |
| Sequence | siRNA sense (21b) GGGTTCTCTTATCAACTCATT / siRNA antisense (21b) TGAGTTGATAAGAGAACCCTG |
| Target | CD82 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:31 + |
| hide properties that link here |
| No properties link to this page. |
