Browse wiki
| Sequence 348 (siCDH1.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Cadherin 1, type 1, E-cadherin (epithelial … Cadherin 1, type 1, E-cadherin (epithelial) Ensembl: ENSG00000039068 UniGene: Hs.461086 EntrezGene: 999 Ensembl Chr16: 67328696 - 67426943 Strand: 1 GO terms: 0003674 0005509 0005515 0005886 0005913 0007155 0007156 0008013 0016020 0016021 0016323 0019538 0030054 0043281 0045177 005126023 0019538 0030054 0043281 0045177 0051260 |
| Design | SiRNA + |
| Name | siCDH1.1 + |
| Sequence | siRNA sense (21b) GGCCTGAAGTGACTCGTAATT / siRNA antisense (21b) TTACGAGTCACTTCAGGCCGA |
| Target | CDH1 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
| hide properties that link here |
| No properties link to this page. |
