Browse wiki
| Sequence 349 (Cdc1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Transcribed locus Ensembl: ENSG0000017031 … Transcribed locus Ensembl: ENSG00000170312 UniGene: Hs.623223 EntrezGene: 983 Ensembl Chr10: 62208107 - 62224616 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004693 0004713 0005515 0005524 0005634 0005876 0006468 0006916 0007049 0007067 0007089 0007095 0016740 0030496 0030544 005130189 0007095 0016740 0030496 0030544 0051301 |
| Design | SiRNA + |
| Name | Cdc1 + |
| Sequence | siRNA sense (21b) GGGGTTCCTAGTACTGCAATT / siRNA antisense (21b) TTGCAGTACTAGGAACCCCTT |
| Target | CDK1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:05 + |
| hide properties that link here |
| No properties link to this page. |
