Browse wiki
Sequence 360 (CENP-E 1 , CENPE1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Centromere protein E, 312kDa Ensembl: ENSG00000106605 |
Design | SiRNA + |
Name | CENP-E_1 , CENPE1 + |
Sequence | siRNA sense (21b) GCTTGTGATGCCATCCTGATT / siRNA antisense (21b) TCAGGATGGCATCACAAGCTT |
Target | CENPE ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
hide properties that link here |
No properties link to this page. |