Browse wiki
| Sequence 40 (siADAM8.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | ADAM metallopeptidase domain 8 Ensembl: ENSG00000151651 UniGene: Hs.501574 EntrezGene: 101 Ensembl Chr10: 134925912 - 134940362 Strand: -1 GO terms: 0004222 0005886 0005887 0006508 0008237 0008270 0016337 0046872 |
| Design | SiRNA + |
| Name | siADAM8.2 + |
| Sequence | siRNA sense (21b) GCATCATCGTCTACCGCAATT / siRNA antisense (21b) TTGCGGTAGACGATGATGCCT |
| Target | ADAM8 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
| hide properties that link here |
| No properties link to this page. |
