Browse wiki
| Sequence 434 (Cthe 1951 , Cthe1951) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | Cthe_1951 , Cthe1951 + |
| Sequence | Forward PCR primer (20b) AAAATAAAAGCCCAGGATTC / Reverse PCR primer (20b) GCATTATCCTGAAGTTCGTC |
| Target | Cthe 1951 ( Ruminiclostridium thermocellum ATCC 27405 ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:46 + |
| hide properties that link here |
| No properties link to this page. |
