Browse wiki
| Sequence 449 () |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Damage-specific DNA binding protein 1, 127kDa Ensembl: ENSG00000167986 UniGene: Hs.290758 EntrezGene: 1642 Ensembl Chr11: 60823510 - 60857153 Strand: -1 GO terms: 0003676 0003684 0005515 0005634 0005737 0006289 0006512 |
| Design | SiRNA + |
| Sequence | siRNA sense (21b) CCTGTTGATTGCCAAAAACTT / siRNA antisense (21b) GTTTTTGGCAATCAACAGGTT |
| Target | DDB1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:40 + |
| hide properties that link here |
| No properties link to this page. |
