Browse wiki
Sequence 450 (Ddb2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Damage-specific DNA binding protein 2, 48kDa Ensembl: ENSG00000012124 |
Design | SiRNA + |
Name | Ddb2 + |
Sequence | siRNA sense (21b) GAGCGAGATCCGAGTTTACTT / siRNA antisense (21b) GTAAACTCGGATCTCGCTCTT |
Target | DDB2 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:05 + |
hide properties that link here |
No properties link to this page. |