Browse wiki
| Sequence 452 (ISIS-327822 , ISIS 327822) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoC*moC*moT*moT*moC*G*C*T*G*G*C*G*G*C*A*moC*moC*moA*moC*moA + |
| Description | Diacylglycerol O-acyltransferase 1 Ensembl: ENSRNOG00000028711 UniGene: Rn.252 EntrezGene: 84497 |
| Design | MOE gapmer + |
| Name | ISIS-327822 , ISIS 327822 + |
| Sequence | CCTTCGCTGGCGGCACCACA |
| Target | Dgat1 ( Rattus norvegicus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:11 + |
| hide properties that link here |
| No properties link to this page. |
