Browse wiki
| Sequence 453 (ISIS-369235 , ISIS 369235) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoG*moC*moA*moT*moT*A*C*C*A*C*T*C*C*C*A*moT*moT*moC*moT*moT + |
| Description | Diacylglycerol O-acyltransferase homolog 2 … Diacylglycerol O-acyltransferase homolog 2 ( mouse ) Ensembl: ENSRNOG00000016573 UniGene: Rn.9523 EntrezGene: 252900 Ensembl Chr1: 156447588 - 156515241 Strand: -1 GO terms: 0003846 0004144 0005783 0006071 0006629 0008415 0008610 0016020 0016021 001674029 0008415 0008610 0016020 0016021 0016740 |
| Design | MOE gapmer + |
| Name | ISIS-369235 , ISIS 369235 + |
| Sequence | GCATTACCACTCCCATTCTT |
| Target | Dgat2 ( Rattus norvegicus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:58 + |
| hide properties that link here |
| No properties link to this page. |
