Browse wiki
Sequence 467 (D1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Dynamin 1-like Ensembl: ENSG00000087470 |
Design | SiRNA + |
Name | D1 + |
Sequence | siRNA sense (21b) TCCGTGATGAGTATGCTTTTT / siRNA antisense (21b) AAAGCATACTCATCACGGATT |
Target | DNM1L ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:42 + |
hide properties that link here |
No properties link to this page. |