Browse wiki
Sequence 47 (H3) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | HIV-1 Rev binding protein / ArfGAP with FG … HIV-1 Rev binding protein / ArfGAP with FG repeats 1 Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694033 EntrezGene: 5179 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 004687683 0008270 0030154 0031410 0043087 0046876 |
Design | SiRNA + |
Name | H3 + |
Sequence | siRNA sense (21b) GCCAAAGTCCTGGCATCAGTT / siRNA antisense (21b) CTGATGCCAGGACTTTGGCTT |
Target | AGFG1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:09 + |
hide properties that link here |
No properties link to this page. |