Browse wiki
| Sequence 479 (mERAAP) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Endoplasmic reticulum aminopeptidase 1 En … Endoplasmic reticulum aminopeptidase 1 Ensembl: ENSG00000164307 UniGene: Hs.436186 EntrezGene: 51752 Ensembl Chr5: 96122270 - 96169648 Strand: -1 GO terms: 0001525 0004178 0004179 0004239 0005138 0005151 0005515 0005576 0005737 0005783 0005788 0005829 0006508 0006509 0008217 0008237 0008270 0016021 0019885 0045088 0045444 0045766 004687221 0019885 0045088 0045444 0045766 0046872 |
| Design | SiRNA + |
| Name | mERAAP + |
| Sequence | siRNA sense (21b) AGCTAGTAATGGAGACTCATT / siRNA antisense (21b) TGAGTCTCCATTACTAGCTTT |
| Target | Erap1 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:42 + |
| hide properties that link here |
| No properties link to this page. |
