Browse wiki
| Sequence 488 (si 057) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) Ensembl: ENSG00000012061 |
| Design | SiRNA + |
| Name | si_057 + |
| Sequence | siRNA sense (21b) CGGACAGUCAGACCCUCCUGA / siRNA antisense (21b) AGGAGGGUCUGACUGUCCGUU |
| Target | ERCC1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:50 + |
| hide properties that link here |
| No properties link to this page. |
