Browse wiki
Sequence 540 (GABBR1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Gamma-aminobutyric acid ( GABA ) B receptor, 1 Ensembl: ENSG00000204681 |
Design | SiRNA + |
Name | GABBR1 + |
Sequence | siRNA sense (21b) TATTGGTTCCTGGGCTGCTTT / siRNA antisense (21b) AGCAGCCCAGGAACCAATATT |
Target | GABBR1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:05 + |
hide properties that link here |
No properties link to this page. |