Browse wiki
| Sequence 552 (siGSK3B.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Glycogen synthase kinase 3 beta Ensembl: … Glycogen synthase kinase 3 beta Ensembl: ENSG00000082701 UniGene: Hs.445733 EntrezGene: 2932 Ensembl Chr3: 121028238 - 121295203 Strand: -1 GO terms: 0000166 0002039 0004672 0004674 0004696 0004713 0005524 0005634 0005737 0005977 0006468 0006983 0007242 0016740 0018105 0030877 0042309 0043066 0046827 0050825 0050826 0051059 006007066 0046827 0050825 0050826 0051059 0060070 |
| Design | SiRNA + |
| Name | siGSK3B.2 + |
| Sequence | siRNA sense (21b) CACTGGTCACGTTTGGAAATT / siRNA antisense (21b) TTTCCAAACGTGACCAGTGTT |
| Target | GSK3B (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
| hide properties that link here |
| No properties link to this page. |
