Browse wiki
| Sequence 585 (cont) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Histone deacetylase 8 Ensembl: ENSG00000147099 UniGene: Hs.310536 EntrezGene: 55869 Ensembl ChrX: 71466091 - 71709623 Strand: -1 GO terms: 0000118 0000122 0000228 0004407 0005634 0005737 0006333 0006350 0006355 0008134 0016568 0016575 0016787 |
| Design | SiRNA + |
| Name | cont + |
| Sequence | siRNA sense (21b) ACAGAACCACGAGAGGTGGTT / siRNA antisense (21b) CCACCTCTCGTGGTTCTGTTT |
| Target | HDAC8 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:39 + |
| hide properties that link here |
| No properties link to this page. |
