Browse wiki
Sequence 590 (HDV-3 , HDV3) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Design | SiRNA + |
Name | HDV-3 , HDV3 + |
Sequence | siRNA sense (21b) CGGACCAGATGGAGGTAGATT / siRNA antisense (21b) TCTACCTCCATCTGGTCCGTT |
Target | AJ307077.1 (Hepatitis delta virus) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:57 + |
hide properties that link here |
No properties link to this page. |