Browse wiki
| Sequence 604 (M HIF-1a) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Hypoxia inducible factor 1, alpha subunit … Hypoxia inducible factor 1, alpha subunit Ensembl: ENSMUSG00000021109 UniGene: Mm.3879 EntrezGene: 15251 Ensembl Chr12: 75002362 - 75048517 Strand: 1 GO terms: 0001525 0001666 0001755 0001892 0001947 0003700 0004871 0005515 0005634 0005737 0006355 0006879 0007165 0009434 0030154 0030528 0030949 0035035 0035162 0042541 0042981 0043619 004544935 0035162 0042541 0042981 0043619 0045449 |
| Design | Primer set + |
| Name | M HIF-1a + |
| Sequence | Forward PCR primer (22b) AAACCAGCAGTTACTCATGCAA / Reverse PCR primer (24b) CATGATCCAGGCTTAACAATTCCA |
| Target | Hif1a ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:50 + |
| hide properties that link here |
| No properties link to this page. |
