Browse wiki
Sequence 631 (AUF1 2 , AUF12) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | heterogeneous nuclear ribonucleoprotein D … heterogeneous nuclear ribonucleoprotein D Ensembl: ENSG00000138668 EntrezGene: 5036 Ensembl Chr4: 83493491 - 83514173 Strand: -1 GO terms: 0000166 0000781 0003676 0003677 0003723 0005515 0005634 0005694 0006350 0006355 0006396 0006401 0016563 0030529 0042309 0050825 005082601 0016563 0030529 0042309 0050825 0050826 |
Design | SiRNA + |
Name | AUF1_2 , AUF12 + |
Sequence | siRNA sense (21b) GCAGCGACGGCACAGCGGGTT / siRNA antisense (21b) CCCGCTGTGCCGTCGCTGCTT |
Target | HNRNPD ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:19 + |
hide properties that link here |
No properties link to this page. |