Browse wiki
| Sequence 631 (AUF1 2 , AUF12) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | heterogeneous nuclear ribonucleoprotein D … heterogeneous nuclear ribonucleoprotein D Ensembl: ENSG00000138668 EntrezGene: 5036 Ensembl Chr4: 83493491 - 83514173 Strand: -1 GO terms: 0000166 0000781 0003676 0003677 0003723 0005515 0005634 0005694 0006350 0006355 0006396 0006401 0016563 0030529 0042309 0050825 005082601 0016563 0030529 0042309 0050825 0050826 |
| Design | SiRNA + |
| Name | AUF1_2 , AUF12 + |
| Sequence | siRNA sense (21b) GCAGCGACGGCACAGCGGGTT / siRNA antisense (21b) CCCGCTGTGCCGTCGCTGCTT |
| Target | HNRNPD ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:19 + |
| hide properties that link here |
| No properties link to this page. |
