Browse wiki
| Sequence 632 (Hormad1) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | HORMA domain containing 1 Ensembl: ENSG00000143452 UniGene: Hs.298312 EntrezGene: 84072 Ensembl Chr1: 148937160 - 148959976 Strand: -1 GO terms: 0005634 0007067 |
| Design | Primer set + |
| Name | Hormad1 + |
| Sequence | Forward PCR primer (19b) GCCCAGTTGCAGAGGACTC / Reverse PCR primer (22b) TCTTGTTCCATAAGCGCATTCT |
| Target | HORMAD1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:52 + |
| hide properties that link here |
| No properties link to this page. |
