Browse wiki
| Sequence 639 (siHSP90AA1.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Heat shock protein 90kDa alpha (cytosolic) … Heat shock protein 90kDa alpha (cytosolic), class A member 1 Ensembl: ENSG00000080824 UniGene: Hs.523560 EntrezGene: 3320 Ensembl Chr14: 101616859 - 101675776 Strand: -1 GO terms: 0000166 0003674 0005524 0005575 0005737 0005829 0006457 0006839 0006950 0006986 0007165 0008150 0030235 0030911 0042026 0042803 0045429 005108235 0030911 0042026 0042803 0045429 0051082 |
| Design | SiRNA + |
| Name | siHSP90AA1.2 + |
| Sequence | siRNA sense (21b) AGAAATAGGTTAAACTGAATT / siRNA antisense (21b) TTCAGTTTAACCTATTTCTAG |
| Target | HSP90AA1 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:29 + |
| hide properties that link here |
| No properties link to this page. |
