Browse wiki
| Sequence 654 (IR-ASO , IRASO ) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoT*moT*moC*moT*moT*C*T*C*G*A*T*G*C*G*G*moA*moC*moA*moG*moA + |
| Description | Insulin receptor Ensembl: ENSMUSG0000000 … Insulin receptor Ensembl: ENSMUSG00000005534 UniGene: Mm.268003 EntrezGene: 16337 Ensembl Chr8: 3155401 - 3279128 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0004714 0004872 0004918 0005009 0005515 0005524 0005768 0005829 0005886 0006468 0006935 0007169 0008286 0009887 0016020 0016021 0016740 0018108 001990387 0016020 0016021 0016740 0018108 0019903 |
| Design | MOE gapmer + |
| Name | IR-ASO , IRASO + |
| Sequence | TTCTTCTCGATGCGGACAGA |
| Target | IR ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:48 + |
| hide properties that link here |
| No properties link to this page. |
