Browse wiki
| Sequence 656 (shIsl1 5 , shIsl15) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | ISL LIM homeobox 1 |
| Design | ShRNA + |
| Name | shIsl1_5 , shIsl15 + |
| Sequence | (49b) ATGACTGGCCTCAGTCCGATTCAAGAGATCGGACTGAGGCCAGTCATTT |
| Target | ISL1 ( Gallus gallus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
| hide properties that link here |
| No properties link to this page. |
